Title:"Gods Logic System: Code Made from Code Made from Blood Represented by Code "
This artwork represents the artists dna data as an open source system. Each letter or base code appears on the screen for one second. The artwork is cycling through all 3.3 billion letters of stanza's dna code. At one second per letter, it will take more than one hundred and four years.
The piece of artwork is time based. To make a note of the complete open source you need to get a pencil and paper and start writing.
Ideally the artworks needs a real gallery to exhibit this piece of work for one hundred and four years. The clock is counting down in reverse. This is is the length of time it will take to take down the whole code at one letter per second. When you enter the work you can see how many years it has been running already.
The allusion of the wok is that we are just code and like the running DNA life runs through a series of events until it finally stops. This artwork will therefore die or stop at the end of the sequence in over one hundred and four years.
EXHIBITION. To be exhibited on large projectors so that the work is mirrored to represent the double helix. Also in a gallery space don't forget pencils and paper.
2004

See installation views below


Photos above by Stanza from installation view in Test Portal Amsterdam. 2005

Image above from 2011. Note the 98 shows it has moved on six years from the installation view that is we are now six years in to the 104 year long project.
GGCAGCAGGCAGGAACTTGTCGCAGGCAGGCAGCCTGGCAGCAGGCAGGAACCTTGTCGCAGGCAGGCAGCCTTGAGACAGTTCCTTGAGTTCCTTGAG
Download a sample of stanza open source code from chromosome 17.
GCAGACTGGCAGGCAGAACCTTGTCGCAGGCAGGCAGCCTTGAGACAGCCTTTTGAG
VIEW IMAGES FROM STANZA DNA LABORATORY 2003
All code and dna source material thanks to the higher powers (maybe) and all testing MRC Clinical Sciences Centre Faculty of Medicine, Imperial College.
This code is derived from my code made in 2003 originally made in 1962

Image above shows Stanza DNA on the end of a stick ie my sequenced DNA. Image (C) stanza

(this version of my DNA based artwoprks was funded by canada council for arts for year01.com)
Context. DNA as Art
The DNA clock is playing with the idea of a code clock, a system within a system. The clock, is a code for life that is represent by time. In fact to count or watch all the 3.3 billion letters will take one hundred and four years disclosing the 'meaning of life' in the process. By sitting in the gallery for one hundred and four years you will also have an exact replica of Stanza DNA and the source code to copy the artist via duplication (clone). Alternatively you can buy my DNA which will be auctioned on Ebay soon.
The DNA is an operating system consists of 3.3 billion bases that is the letters ACTG. There are also the chromosomes and either the X or Y depending on if you are male or female. My thinking is if you remove parts of the operating system then you stop working. Indeed part of any OS consists of objects, functions or blocks of code that do specific jobs but also relate tasks to the whole. This idea is expanded when we consider that some of the code can actually change, evolve or shifts over time. An interesting term that relates to a huge chunk of the code sequence; in fact more than 95 percent of all DNA, was called "Junk DNA" by molecular biologists, because they were unable to ascribe any function to it. However the issue here is that the function of the code is not yet properly understood. What does the function do within the operating system?
The original concept and intention as well as being developed as an artwork was to make a business. In short a database placed online would require users to submit a copy of their DNA. Once the first 100,000 subscriptions had been made then an IPO, an initial public offering would be made. The company formed on the stock market would exploit any patents, intellectual property and any derivable income would be shared among the subscribed user group. The shareholders in this company would be the subscribers who have placed their DNA source code. This project was to counter the exploitation of DNA by large corporations who do now exploit the right to this source code, a code that should be equally beneficial to all. This database is still in progress and further funds and financial backers are needed.
This concept is copyright / and left. Stanza 2003
Code represented by code and taken from blood.