 |
A series of online artworks by Stanza inspired by the human genome sequence and developed from dna profile which are sequenced from my blood. The online artworks are investigations into genetic codes mapped and re assembled online. The series enables a cross reference all the code on the genome sequence allowing you to intermix or breed your own variable; you can look at the new mix of chromosomes in real time; on line. You can also keep and print this pattern from the website. Works are enabled by dna code extracted from my blood. The sounds and images of code make audio visual self portrait versions. Full text. |
 |
Genomixer....(three versions online) An interactive online installation, allowing you to cross reference all the patterns on the genome sequence and intermix or breed your own variable allowing you to look at the new mix of chromosones in real time on line. Input whatever gene you want and scramble the results. The genomixer uses Stanza dna which has been sequenced by Imperial college London. Genomixer was exhibited at the Site Gallery Colchester and in Cambridge as part of Respond.
|
 |
Mutator.Three versions online. Mutator is a generative audio system built , that plays interactive non linear audio over the net. The sounds are mapped to the genetic codes. This is a complete audio visual online generative system. Our dna is a long line of code a very long line, represented by the letters a,c g, and t. These are the building blocks for dna, they are a set of bases. This code gives us massive clues to who we are and how we work. The sounds are based on stanza dna structures the images based on stanza dna profile. The result is three new generative online musical systems that evolve through sequences of DNA. One has a special phonetic random music system built into the piece.
|
 |
Junker. Some generative experiments in replication. They divide and sub divide. Six in the this series. Mixing down the DNA sequence. The code just keeps adding to itself forwever down a DNA sequence. The idea is to track anomolies inside the code, special featured and unusual variations. Scientists spend their time analysing specific areas of the billions of letters of code. These go searching for complex patterns that occur deep inside. The junker series 1 - 6 searches for junk inside each of my chromosomes.
|
 |
Geno. The work 'geno' is used for the pattern maker. Genome baby maker, is a room in pink or blue set up virtually to allow you to see how the newly designed baby might look in the newly designed room. The baby blue room and the pink room with baby sounds online. A number of artistic artefacts will be made and sold from this online shop.It allow you to keep and print this pattern, ( indeed the protoype is already online. IE where you se a P in the top right of screen this is a print function. So these can be taken away and sent to friends or used in the nursery. |
 |
DNA portraits Mushy spaces based on dna profiles. These are random tests. Portraits to come include yours ( if you send in you dna ) .....and the famous "Dead and Burried" area; the DNA /genetic cemmetry. First we will go to Graceland, home of Elvis, and make an Elvis version (which sing obviously). We might even invest in an Elvis clone. The lab is working on this. It safer to simulate than build. I will be developing online clone for future code morphing.
|
 |
DNA Space. A 3 d generative space playing through variations of dna in a morphing 3 d architecture. Move around it and the shape moves with you. Click through and load new behaviours or wait and new codes are loaded into the architecture.Generative 3d dna architectures. Based on my dna profiles. A building whose construction is based on genetic identity. The true family home, a gentically engineered morphic 3d structure. These are example protoypes for a real space. A space where the virtual becomes real. Commission a building, real or virtual. |
 |
Cloned sites Infected and cloned sites include the tate, bbc, and the ica. These sites have been cloned and infected with stanza dna. Issues around mutation and genetic modification complicates issues of IP and ownership. Who has the right to do this. These sites have been modified with my dna.
CCATAGGATGTTGATCGCTCGATGCTTCTGCTCGATCGATCGGCTTCGCTCCTCTTCGCCTCGAGCTCG |
 |
Musica Portrait. Open source A unique open source labyrinth of dna sounds. There are three system online. One playinng chromosome X bases the other playing chromosome 17 bases. One include a 24 sounds. This loads, then you need to switch the sounds off while your computer processor adjusts. Open source movement and philosophy is important to the ideas of genetics and dna. Exploitation of the dna code should be for all. You can mix the sounds and adjust endlessly. |
|
|
|
ALL ideas copyright Stanza ...(patents pending). 2000-2003 |
|
|